نمونه سئوالات زیست شناسی پیش دانشگاهی فصل اول
توسط : 23456ehsansh

کدام RNA اطلاعات موجود در DNA هسته را به ریبوزوم حمل می کند؟

الف- RNA پلی مراز       ب- t RNA          ج- r RNA          د-  m RNA         

راه انداز و عوامل رونویسی به ترتیب از چه مونومرهایی تشکیل شده اند؟         

 الف- نوکلئوتید – اسید آمینه                         ب- اسید آمینه -نوکلئوتید 

 ج- نوکلئوتید – نوکلئوتید                             د- اسیدآمینه – اسید آمینه  

علت بیماری الکاپتونوریا چیست؟     

 الف- نقص ژنی درسنتز آنزیم سنتز کننده ی هموجنتیسیک اسید 

 ب- وجود هموجنتیسیک اسید درادرار     

  ج- نبودن آنزیم سنتز کننده ی هموجنتیسیک اسید  

د- نقص ژنی درسنتز آنزیم تجزیه کننده ی هموجنتیسیک اسید                

هررمز سه نوکلئوتیدی در tRNA وmRNA  به ترتیب چه نام دارد ؟             

الف- کدون – کدون                                  ب- آنتی کدون – کدون    

 ج- آنتی کدون – آنتی کدون                       د – کدون – آنتی کدون

کدام یک ازموارد زیردارای اینترون است؟                                   

الف- mRNA پروکاریوتی                             ب- mRNA بالغ انسان   

ج- mRNA  اولیه قارچ                           د-   mRNA بالغ باکتریE.Coli

در جاهای خالی کلمات مناسب بنویسید .  

الف- اگرکدون mRNA ای ، UAC باشد ؛ آنتی کدون مربوط به آن ............. است .

ب- در جریان ترجمه ، کدون  ............ هیچ گاه در جایگاه P ریبوزوم قرار نمی گیرد .

پ - اگر رمز موجود بر روی DNA ، ACG باشد ، رمز tRNA مربوط به آن ..........  می باشد .

ج- مناطقی از mRNA اولیه که ترجمه نمی شود و حذف خواهد شد ، ......  نام دارد .

د- به انتهایA CC از tRNA ها ...................   متصل می شود .

 باتوجه به ملکول mRNA ی مقابل ACCAUGAUGUCCAUGCCCUAA

                                                ج                   ب                       الف

– در برابر موارد زیرعلامت ص  یا غ  بگذارید .   

الف - کدون الف اولین کدونی است که آنتی کدونش به جایگاه Aوارد می شود.(         )

ب-tRNA ی مربوط به کدون (ج) فقط می تواند به جایگاه A وارد شود. (           )

ج- کدون (ب) می تواند در هردوجایگاه AوPبه ترتیب  وارد شود. (           )

د- کدون (ج) فقط می تواند به جایگاه Pوارد شود.  (              )

مراحل مختلف پروتئین سازی که در زیرآمده است را به ترتیب، از شروع به پایان ترجمه، مرتب نمایید.

الف- tRNA با دو آمینو اسید در جایگاه A قرار دارد. و Pخالی است.  (          )   

ب- ریبوزوم بر روی  mRNA حرکت میکند. (        

ج- کدون UGA، در جایگاه Aقرار میگیرد. (        )

د- tRNA آغازگر با یک آمینو اسید در جایگاهP قرار دارد. وجایگاه A آماده پذیرش tRNA بعدی است0(        )

ح-  آنتی کدون با کدون AUGدر جایگاه P جفت می شود. (        )

خ-  جایگاه A وP  بوسیله tRNA اشغال شده است.  (          )

به چه دلائلی نظریه یک ژن – یک آنزیم تبدیل به نظریه یک ژن – یک رشته پلی پپتید گردید؟(دو دلیل ذکر نمایید)

 به چه دلیل DNA نمی تواند مستقیما برای ساختن پروتئین مورد استفاده قرار گیرد؟

به چه دلیل رمز های وراثتی نمی توانند کمتر از سه حرف باشند؟

دو دلیل ذکر نمائید که دانشمندان بر اساس آن به این نتیجه رسیده اند که مولکول RNA مولکول میانجی برای پروتئین سازی است.

تفاوت همانندسازی ورونویسی رابنویسید0 (2مورد)

جهش  نقطه ای چگونه می تواند برمحصولات ژن(پروتئین)تأثیر بگذارد؟ 

تفاوت mRNAچند ژنی با mRNA تک ژنی چیست؟

نقش عوامل رونویسی و افزاینده را در تنظیم بیان ژن های یوکاریوتی بنویسید.

اصطلاحات زیر را تعریف کنید0

الف- تنظیم بیان ژن :

ب- جایگاه آغاز رونویسی :

ج- اپراتور :

شکل زیر بخشی از مرحله آغاز پروتئین سازی رانشان می دهد ،نام اجزای شماره گذاری شده را بنویسید.

شکل زیر اپران لک را درباکتری E.Coli نشان می دهد با توجه به این شکل به سئوالات زیر پاسخ دهید؟

الف- قسمت های مشخص شده را نامگذاری کنید0

ب- کدام نوع اپران (روشن یاخاموش)رانشان می دهد0

ج- چگونگی آن را شرح دهید0

 

جمعه 15/7/1390 - 20:51
پسندیدم 6
UserName